adoran2005 adoran2005
  • 03-09-2019
  • Mathematics
contestada

Evaluate 5+(3x+6)/5+x for x=-3

Respuesta :

ncalvoa ncalvoa
  • 04-09-2019

Answer:

5+(3x+6)/5+x when x=-3

5 + (3 (-3) + 6) / (5 + (-3)) = 1

Step-by-step explanation:

You would have to replace the given number (-3) in all the x you have in the equation, and just do the math

Answer Link

Otras preguntas

What is the gravitational potential energy of an object that has a mass of 8 kg and is 11.2 meters above Earth? Round your answer the nearest whole number. A. 8
Which type of electricity is a one-time event, caused by unbalanced charges trying to become neutral again?
Help! Evaluate the logarithmic function for the given value. f(x) = log3 x for f(243) f(243) = M
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Plz help due tomorrow ill give Brainlyest if correct
PLEASE HELP ME OMG: Rectangle QUAD has coordinates Q(0,0), U(0, 3), A(5, 3), and D(5,0). Q'U'A'D' is the image of QUAD after a dilation with center (0,0) and sc
El auxiliar del vuelo habla a dos pasajeros. * me te le nos i les
please help me with this math problem ​
1. Name the protists fitting each of the following descriptions. Write down only the correct name next to the relevant question number. 1.1 A protozoan which mo
Should expressive speech have any restrictions? why or why not ?