elizabeth4775 elizabeth4775

01-05-2020
Mathematics

contestada

Convert 52.0 hm to cm

Respuesta :

BradleyAlfred BradleyAlfred

01-05-2020

Answer:

520000 cm

Step-by-step explanation:

multiply the length value by 10000

Answer Link

rios12andrea12 rios12andrea12

01-05-2020

Answer:

52 = 520000

Step-by-step explanation:

hope we can be friends

can i please get brainliest

Answer Link

Otras preguntas

1/4 equals Z /20 what does z equal

If a strand of DNA has the following base sequence, what would the base sequence of the mRNA that is transcribed be? DNA sequence: TAC CAT GTG AGT AAC CGT CCA A

what muscles keep the body together?

pls explain this to me

Which level of organization forms the fundamental base for all other levels in the hierarchy of life? * Cell O Tissue Organ Organism

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

What is the Heat Source in the experiment?

If the slope is -3 and (1, 2) is a point on the line, what is the equation of the line?

A person walks 13 mile in 19 hour. The person's speed is ____ miles per

Which expressions are equivalent to x + 2y + x + 2? Choose all answers that apply: A 2(x+y+1) B 2x + 4y +4 C None of the above