fetskoad fetskoad
  • 04-06-2020
  • History
contestada

Justify the outcome of the civil war

Respuesta :

4804180730 4804180730
  • 04-06-2020

Answer:

Slavery was permanently abolished in America and the United States was United once again. The Civil war was justified simply for the fact that if the South had not seceded, it is possible that slavery would have gone on for much longer and that the divide between North and South would have deepened beyond repair

Explanation:

Answer Link

Otras preguntas

Need help asappp plzz helppp
circadian rhythm refers to
What is the lowest level of measurement that a median can be computed?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Social disparity was one of the major causes of french revolution. Justify the statement
During translation, the mrna is read in groups of three bases. true false
Under the articles of confederation, political power and authority ultimately rested with the ________.
The basis of freedom of religion is found in which two principles in the bill of rights
Why is it important for scientists to use blind tests?
When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False