Seudónimo Seudónimo
  • 04-09-2020
  • Mathematics
contestada

Any one please help ASAP 50points Find the cube roots of -1,8,-27,64

Respuesta :

JayV2005
JayV2005 JayV2005
  • 04-09-2020

-1 = ³√-1 = -1

8 = ³√8= 2

-27= ³√-27 = -3

64 = ³√64 = 4.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
Did feudalism create a stable form of government?
Please help solve, thanks in advance!
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
how can you write 0.45 as fraction and a percentage ,please show work
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
In which system of government would states function independently of each other?