sakuraanorris14 sakuraanorris14

01-03-2021
Mathematics

contestada

Find the rate of change/slope:(6,-9) (7,9)
What is the rate of 6,9 and 7,9

Respuesta :

ifrahnasim13june2003 ifrahnasim13june2003

01-03-2021

Answer:

0

Step-by-step explanation:

slope = y2-y1 / x2-x1

slope= 9-9/7-6

slope = 0

Answer Link

Otras preguntas

Which Of the following about the land between the rivers is correct?

[tex]\frac{9}{14} / \frac{4}{3}[/tex]

Find the area of this polygon. Enter your answer in square units.

what instrument would you use to detect radiation?

what do chemical reactions that absorb energy need to occur

significado expresión manos inquietas del aire y significado expresión dedos antojadizos del viento

Luna programs two number generating functions. If you plug in an domain , it generates a new output value. Her first function rule is f(x)=x+7. The second funct

what woman won the french open in 1990, 1991, and 1992?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which statement best describes the effects of Japan's Meiji Restoration?