kaylafoster
kaylafoster kaylafoster
  • 01-03-2021
  • Mathematics
contestada

Find angle Picture below

Find angle Picture below class=

Respuesta :

pomeroytraiden
pomeroytraiden pomeroytraiden
  • 01-03-2021

Answer:

14°

Step-by-step explanation:

Need 1 more brainliest

Answer Link

Otras preguntas

Gwendelyn, who is a witch, went on an international witch tour. The following table shows the number of spells that she cast in each country. Country Number of
a web music store offers two versions of a popular song. the size of the standard version is 2.9 megabytes (MB). the size of the high-quality version is 4.8 MB.
Chas build a circular pattern for his dog The radius of the pen is 9 feet how much fencing did Chaz use for the pen
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
What conclusion is BEST supported by the previous paragraph?
Help new here please
Paddling with the current in a river, jake traveled 16 miles. Even though he paddled upstream for an hour longer than the amount of the time he paddled downstre
why did Jefferson oppose the national bank​
Help me first on that answers wins brainliest!
The formula for the volume of a cylinders to the formula forth in both cases, you multiply the area of the base times the height cylinder is related to the form