hannahlaurencearnuco hannahlaurencearnuco
  • 02-12-2021
  • Health
contestada

Promote Effective ways on how you can keep your respiratory system healthy.
Btw this is due in dec 3 and i need to submit this now, ASAP !!!!!!!!!!!!!!!!!

Respuesta :

jsebastian1228
jsebastian1228 jsebastian1228
  • 02-12-2021

Answer:

•Get Regular Check-ups.

•Exercise.

•Don't Smoke.

Explanation:

Pls make me the brainliest

Answer Link
valleybo valleybo
  • 02-12-2021
Drink water, sleep 7 hours every night, and be on a healthy diet
Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Find the M<E.P(2x + 10)"- (2x - 20)a. 74 degreesb. 90 degreesc. 158 degreesd. 540 degrees​
Give the solutions to 23 + √36
Can someone please explain what a unique triangle is? Please help
Taylin buys 5 ounces of tea leaves for 10. At this rate, how much money does she need to buy 12 ounces of tea
when Lisa and Tom had their first child. they put $7,500 into a savings account, that earns 6% compound interest. if Lisa and Tom did not add or remove anythin
Accounts receivable turnover and days’ sales in receivables For two recent years, Robinhood Company reported the following: 20Y9 20Y8 Sales $7,906,000 $6,726,00
Find the measure of Arc QRM
Why did the unemployment rate go down from 1933 to 1937?
Which best defines matter? O A. All the living things on the planet O B. All solid objects that can be seen O C. Anything in the atmosphere O D. Anything that t