summerorr20
summerorr20 summerorr20
  • 03-12-2021
  • Mathematics
contestada

- - Evaluate 3(x-4) + 2x - x2 for x = 3. + O A. 6 O B. -6 O c. 2 OD. -2​

Evaluate 3x4 2x x2 for x 3 O A 6 O B 6 O c 2 OD 2 class=

Respuesta :

damianr0927
damianr0927 damianr0927
  • 03-12-2021
The answer will be -6
Answer Link

Otras preguntas

all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
How do you write fifty-seven thousand,eighteen. In standard form
the reproductive system of a male mammal provides
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr