karolp4105oxbvz9
karolp4105oxbvz9 karolp4105oxbvz9
  • 02-03-2018
  • Mathematics
contestada

followed your directions @ninc and I got this, but I don't think it's right

followed your directions ninc and I got this but I dont think its right class=

Respuesta :

musiclover10045
musiclover10045 musiclover10045
  • 02-03-2018
volume of the cylinder  = PI x r^2 x h
  3.14 x 1.5^2 x 10 = 70.64

volume of the triangle base:
1/2 x l x h x w

1/2 x 11.2 x 12.5 x 2 = 140

total volume = 140 + 70.64 = 210.64 cubic inches

Answer Link

Otras preguntas

a antonym for biosphere
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
The section of the small intestine between the duodenum and ilium?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
in what area of Europe were the majority of warsaw pact countries
does a human body use neon???