ClintEastwood
ClintEastwood ClintEastwood
  • 03-05-2018
  • Biology
contestada

Which planet has a greater mass than the combined mass of all the remaining planets and their moons?

Which planet has a greater mass than the combined mass of all the remaining planets and their moons class=

Respuesta :

lsb2413
lsb2413 lsb2413
  • 03-05-2018
id say Jupiter cuz its huge. it's the largest planet in our solar system.
Answer Link
Аноним Аноним
  • 03-05-2018
Third options Jupiter is the correct answer.

Jupiter it has a greater mass than the combined mass of all the remaining planets and their moons. Jupiter is 5th planet from the sun, is about 484 million miles away.

Hope it helped you.

-Charlie
Answer Link

Otras preguntas

How do you put allele in a sentence
how can you write 0.45 as fraction and a percentage ,please show work
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
How do I do trebuchet calculations????? Help me please
accurate estimation 719-348
how do you say theatre in Spanish
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5